I addressed this statement before. I said you are right. Nature needs no "creator." Nature is programed to manifest by its own design. No creator needed.



It is not "non scientific" if you use this definition of science:





This is true. Anyone "schooled in logic with a cognitively honest and objective view point" would not dare venture beyond his restrictive scientific boundaries.



Yes, it was designed to do that. Seriously.

It keeps the observer (us) focused on the objective (objects) so "things" can continue to exist. (Quantum mechanics-- that which is not looked at ceases to exist.)

It was all in the plans.

So you scientists keep looking and observing and recording and measuring and affirming. That could be the very thing that holds the fabric of this universe and this reality together!

No, that's definitely solipsism. The other words were just there so people would know what I was referring to because I felt I should prime people's vocabulary to make sure they knew what that word meant.

You're right, I've only said that legos built up as a castle would be order and legos scattered when a club hit that castle should be disorder. How could you ever find the implicit definition in that?

And again, since you have offered no other meaning, my meaning stands because no other alternative has been offered. In the vernacular, put up or shut up.Thermodynamics for 200.


You cause people to respond to you like this. The ideas you express only start people questioning you but it's the way you interact that makes everyone so hostile.

Importantly, this means nobody came here with the interest of tearing you down.

When you learn about the history of which scientists discovered which things you hear about a lot of people that hated each other. They disagree entirely because they're so disgusted by each other and they can't even stand to be in the same room (sometimes even when it's an auditorium,) but even in that situation one can gather up evidence for their work and the proof does it's work.

People disagreed with Columbus about it being possible to sail to another continent through the Atlantic but he went and did it and then made several return trips. He gave proof and then afterward people agreed, not the other way around.

Like hell you have. You've been able to show that you don't understand many of the physical sciences or logic fallacies.

DNA is a relatively arbitrary information molecule. Non-Earth life could very well use other carbon chain molecules for the same purpose, though relatively small and stable ones should have an advantage for obvious reasons.

Well I think I can rule out you being a biology teacher. The human genome project was a particular venture to sequence only the DNA of humans that took 14 years to complete but helped to drive advancements in DNA sequencing machines.

Genetics in general support the universal common ancestor concept though with more recent understanding of how much less distinct the species boundary was early on the tree of life has what resembles, slightly, roots. From DNA it's not possible to say that the original cell arose only once as the common ancestor itself may be have been a chimera of chemical products.
But presuming it did just happen once there was basically some incest in the family tree, though be careful to understand that context as at this point there would not have been sexual reproduction yet.

That's a really inaccurate statistic. People have been saying that before the human genome project (and as we sequenced the full genomes of humans first we would have only had certain viruses and bacteria to compare it to. Currently we've sequenced most or the things we regularly eat and several species of interest.

But this is easily misleading. Sequencing a full genome is still expensive so a great array of techniques for picking out particular stretches to sequence. Often months and months of narrowing it down are preferable to paying the fee to sequence a large chunk of DNA.

Your statistic is most likely referring to mitochondrial DNA but who knows how many steps of the telephone game it could have gone through before you heard it.

Now, we do share surprising details with things even so different as bacteria. The general trend is that proteins inside of the cell are very nearly identical but plants, animals, and fungus (and some things I'm not going to explain,) have their major differences in proteins that stick through the membrane, which happens to be how cells communicate between each other. The same chains of interactions are there but the first step that sets them off is in the membrane for us so other cells can control it.

That would be a good reason but it's clear you don't know the chemistry. There are hundreds of amino acids of varying types but we use only a particular set of 21. There are a few microorganisms that have a single change in their genetic code that uses a different amino acid and it works. It could work for us but we just don't use it.

Likewise there is a whole lot of other chemical setups that we COULD use but don't. There were lots of other chemicals available to us but much like a racing car you can't tack on every option there is if you want it to go fast; you've got to streamline things.
And some early cells did and we're all descended from them.

If you want chemistry tutoring I can go into tons more detail~

Not at all. It could take thousands or millions of years for nonliving material to make all the parts for proto-cells but something like a bacteria- well those can divide in an hour if conditions are about as harsh as they can possibly handle and if you keep doubling like that you get billions of cells in just two days. Think how fast those would get into just about every corner and crevasse and you can see how they'd get everywhere and gobble up all the organic material to make more of themselves in the blink of an eye compared to how long it would take a second early cell to form.

Once there is anything to compete with abiogenesis doesn't have a snowballs chance in hell but if left alone for a million years it might happen practically everywhere it possible could.

Inaccuracies aside that's pretty good. We've actually got the tools to start on it now and there are several people working on making a cell from scratch (to varying degrees,) but sadly, they probably won't get full results this decade.
But hey, you've got to start somewhere if you ever want to figure out how things work.

For life like ours you need something like 30 genes to have a chance to function (based on comparing bacteria.) After we've worked that out in full detail (or close,) people will be able to realistically work on actual "from scratch" systems to accomplish the same thing.

Immediately. Mutations aren't programmed into the DNA, they happen with external conditions. Different sunlight, chemical intake, temperature differences (and really just about anything) can cause them and it's effectively impossible to put two copies in so identical an environment.
(Plus background radioactive decay isn't something we can any control over so we'd need whole other ways to make things "identical.")

You know how kids have a 50/50 chance of being a boy or girl? It's like that. If you had two identical sperm fertilize and egg you'd get the same gender child but you couldn't ever make the whole sex act so identical to definitely get that same result. Single parts in a test tube or petri dish and sure, you can control which will happen but as you add factors in it gets much harder to control.

Well with sexual reproduction "diverge" refers to when the immune system makes the fusion of sperm and egg impossible but the lines are fuzzier with asexual reproducers.

I know all about that n_n
But is that the "science" you taught?

Well if you want to think of it like that the deoxyribose backbone is the hard drive and the nucleotides are the program.

It's important to recognize that all of the parts that translate the program are like the programming language- DNA alone is just like a meaningless string of 1s and 0s if you don't have the right stuff to decode it.

-and like I said with JB, these aren't perfect comparisons. These are the closest I can compare and hopefully you get the general idea from it.

So basically your evidence is "it seems crazy to me"? Of course new information doesn't sound like it makes sense in your understanding of the world- it's new. People thought the Earth going around the Sun instead of the other way around was too crazy to be true but they kept looking and people became familiar with more of the details and eventually people realized "ok, the way we thought it worked was too crazy to actually be it." (In particular the geocentric model with epicycles was wrecked but moons orbiting Jupiter and Shadows on the face of Venus ((sometimes it had to be closer than the Sun and sometimes further,) but these weren't absolute proof; it's just that that was the point where people understood well enough to recognize how much they would really have to do to make the geocentric model really work.)

That's not a valid argument. Sorry but anybody acquainted with fallacies knows not to accept arguments from ignorance or ridicule.

So basically you're saying it is irreducibly complex? That argument was shot down back in Kansas.

I don't see the connection. Why shouldn't the results of the big bang act this way without a designer behind it? Seems like most of it is just the simple math of "things that happen more often are the ones you will see the most of."

Again, why? What's the limit of what things without design should be able to do? Why is that the limit? If you've designed so many things why not say that too few things have gone wrong for it to be designed?

What scientists?

Are you referring to these people who totally abuse and misrepresent science for their own philosophical agendas?

There is no respectable way that science can be used to support a conclusion of no-design.

That's a total farce to begin with.

Look at the arguments that are being given for that:

The only argument they truly have is that their claim that happenstance should somehow be a simpler "explanation" than design, and they appeal to Occam's Razor as their "scientific support" for that absurd conclusion.

Is that even the "Scientific Method"?

I don't think so!

That's an utter misunderstanding of both the "Scientific Method" and Occam's Razor.

The Scientific Methods does not say, "Ignore all evidence and take what you think should be the simplest guess in your own personal opinion!".

That is not science!

Science says to observe the evidence, and then try to explain THAT as simply as you can and still actually explain it!

Was Classical Newtonian physics simple? Yes!

Did it explain? Well, it seemed to for a while until we found things that it couldn't explain, then we had to give it up even though it was a 'simple theory', it still failed to explain.

So being simple is not enough!

It must also explain!

We had to give up that simple explanation in favor of General Relativity and quantum mechanics, simply because the simple explanation no longer explained anything.

We're even finding out that these more complex theories fail to explain everything!

Scientists have invented String Theory to try to explain things. It's extremely complicated and hasn't yet explain anything.

So where does this passionate argument that explanations must be simple come from?

It's not from Occam's Razor. Because Occam's Razor doesn't say anything about explanations needing to be simple.

All that Occam's Razor says is that IF you can explain something simply don't bother making it more complicated. Because you already have a simple explanation! Why bother dreaming up a more complex one?

But Occam's Razor can't be applied to a guess that the universe was happenstance, because that guess, doesn't explain anything, nor does it even fit the data!

The data suggests that something more than happenstance is going on!

So why should scientists ignore the evidence in favor of a supposedly "simple" guess that doesn't even explain anything?

And they call that, "The Scientific Method"?

It can't even be justified via Occam's Razor!

It's not even an explanation and it doesn't even fit the evidence that we observe.

So how does it even qualify as science?

It's not science.

It's a gross misrepsentation of science being used to try to shove an atheistic philosophy down the throats of people in the name of science.

If you people want to argue against particular religions, be my guest. You should be able to find enough ammunition to argue against their mythological dogmas without having to abuse science in the process.

In the case of the Bible, just argue that mankind cannot possibly be held responsible for bringing imperfections and death into the world because science has legitimately shown that imperfections and death existed long before mankind ever came on the scene.

That should be enough right there.

No need to take a stupid stance against intelligent design just to try to shut up bigoted religious fanatics.

Let's get our priorties in line with reason.

Let's not let religious mythologies turn scientists into atheistic fundamentalists just because some religious suck.

That's going way overboard.

Even if this religion was designed by some intelligence that doesn't support the ideologies preached by many religious dogmas.

That's not an automatic given and fears that it might be taken as a green-light for that is an misplaced fear.

It's far better to take the stance that evidence for intelligent design does not automatically mean that any particular religious dogmas are true.

The Bible holds that mankind is responsible for bringing imperfections and death into the world. That's still false based on scientific evidence, even if Intelligent Design is true!

We have scientific evidence that imperfections and death existed long before humans evolved. So that dogma is caught in a lie no matter what!

Well of course that must be qualified. It cannot be said definitively that a “proper and conclusive argument” is impossible. Only that one has not yet been observed.

But the interesting thing there is that the only proper and conclusive argument possible would be to actually observe an instance of intelligent design, in which case, “logical argument” would be moot.

And personally, I consider the man/machine interface research done at PEAR to be exactly that – direct scientific observation of intelligent design. (Not of “an entire universe” of course. But at least a “portion of” a universe. But that is enough to open up the qualitative category. From there it’s just a matter of quantity.)

If one considers time to be a “component of nature”, then that statement strikes me as being no less trite than any other statement. It’s simply stating that time always existed. One might just as well say “infinity is infinite” or “an apple is an apple”.

I don’t think it does – again referencing the PEAR research.

Weak how? How do you measure the weakness?

With “Logic”?

Well in that case you would be absolutely right.

But again, since logic itself is a creation, all you’re saying is that the contents of the box cannot prove the existence of a creator of the box.

And I don’t see anyone disagreeing with that.

If by “everything we learn about nature” you mean “everything science learns about nature”, then I have to point out that no purpose or design has ever been looked for by science. All it ever looks for is form and interaction. By it’s very nature it cannot point to purpose or design. It’s very foundation requires that it specifically ignore purposed and design.

So “everything we learn about nature points away from purpose and design, to form and interaction” is not all that strong of an argument either.


In summary, the arguments against design all amount to simply “because we can’t see anything but the inside of the box, there is no reason to assume that the box has an outside.”

Well, that’s fine for scientists. That’s their job – to observe and categorize the contents of the box.

The job of Philosophers, on the other hand, is to beg the question – what’s outside the box?

What if “creation” outside the box had the same qualities as creation inside the box? I.e. subjective purpose and intent. What would that explain?

Well, it would explain a lot. It would explain pretty much all the paranormal/metaphysical phenomenoa every observed. And it wouldn’t contradict anything science had already explained.

Works for me.

Then I’ll just say that I don’t agree with solipsism.


That must be true because I am cause and everyone else is effect. I control everyone and there’s nothing they can do about it.

Well I’ve always maintained that one creates one’s own reality, so I cannot deny the absolute truth of what you said there.

It’s all my fault.

I'm pointing out that even if there are multiple Universes, it's more likely that none of them are infinite, and judging by the behavior of this one (i.e. expansion and possible collapse) I'd say it's safer to assume that it's less probable that any of them are infinite. Saying that this is probably a Multiverse, like that suggested by String Theory, seems a lot like you're adding probability where there isn't necessarily any likelihood at all. If String Theory really is correct (and by all means, I hope it is) then yes, there are multiple Universes and up to or more than 11 dimensions.

Thank you for the offer, that is very kind of you, but I have no need for tutoring in chemistry I'm fully aware of the principles of chemistry.

You got caught up in some 'crosstalk' there between myself and Redykeulous. I was just sharing with Di some interesting things about DNA because I knew that she would find them interesting. However, those conversations had nothing to do with my original argument.

My original argument is based on the fact that the chemical elements are so few, (only about 100) and that they clearly aren't happenstance. They are clearly all related very dependently. This is shown by both Mendeleeve and by Quantum Mechanics.

The point being that a molecule like DNA wouldn't even be able to exist in a genuinely chaotic universe. So by the time we get to DNA we're long since past the edvience for design.

So once you have DNA in your hands, you're already holding the evidence for design.

My discussions of DNA were just sharing interesting ideas with Di.

DNA would not even be able to exist in a genuinely happenstance universe. A genuinely happenstance universe wouldn't be 'clean' enough.

Infinity is the key to the underlying structure of all things.

Assumptions on the finite nature of Nature.

Despite the harshness of attacks, David Bohm remained unswerving in his conviction that there was more to reality than Bohr's view allowed. He also felt that science was much too limited in its outlook when it came to assessing new ideas such as his own, and in a 1957 book entitled "Causality and Chance in Modern Physics", he examined several of the philosophical suppositions responsible for this attitude.

One was the widely held assumption that it was possible for any single theory, such as quantum theory, to be complete. Bohm criticized this assumption by pointing out that nature may be infinite. Because it would not be possible for any theory to completely explain something that is infinite, Bohm suggested that open scientific inquiry might be better served if researchers refrained from making this assumption.

If I may ask? (just out of curiosity):

Why do you hope that String Theory is correct?

Because it's a marvelously elegant theory, and is as of yet the closest we've come (mathematically, at least) to unifying Quantum Mechanics with General Relativity. Because the concept is so intriguing I would just very much like it to be correct.

Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div


No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?

And now that I think about it, one could simplify it even more and just say “the components of nature are” and leave it at that – no complex investigation, explanation or understanding needed.

Yeah, fun vid. I like the background music. Gives it sort of a humorously sarcastic, "keystone kops" kinda feel.

http://www.youtube.com/watch?v=o2RD4vTuPN0&feature=fvw

No. If God wanted to be revealed we'd know. There are lot of reasons other possible designers would be limited in action.

That's an awfully limited number of ways we could be the designers. Why couldn't we have designed this without knowing we were doing it do example?

That or cause and effect aren't quite so definite as we wish they were.

Not so much the math. The trouble is that when a photon hits something and bounces back it nudges it a little bit. Thanks to this if we figure out how fast something was going we moved it around enough that we don't know where it was and if we figure out where it was we bumped it enough that we don't know how fast it was going.

Non-particle based information gathering might not be impossible in our physical forms. If you accept psychics and things they can't be doing what they do with everyday particles and the exotic ones usually wouldn't interact with our matter much anyway, much less whatever they wanted to get information from.

Or it's not information at all. Things like radioactive decay happen in statistically predictable ways but the decay of a single atom doesn't even have quantum causes behind it. If you want to talk quantum physics you need to accept that decay as an effect without a cause.

The hell? We can still find out any particular thing, just not certain combinations and other than stuff like the "let's try to make ultra-identical twins" scenarios knowing all of that wouldn't have much practical use anyway.

So if the designer wanted to be revealed it would but instead we have to settles for the stuff that... uh, reveals it? What? You're not even making sense.


And there are people in here that aren't happy with you having free speech but that doesn't have any impact on your having it or not.

Well ya, mud doesn't contain the green and red pigments you see in that and probably wouldn't do a good job of the blue ones either.

Meanwhile non-life has all of the "pigments" and once you get certain combinations of them they go making more of themselves.

I know I've been a day or two behind in this but I'm pretty sure my post where I explained that you were wrong about there only being 100 was before this.

CAGGACGGACAACATGTCAGAGCTAGCTACCATGCATAGC
Doesn't mean squat to you does it? Picture that stretching on for hundreds of thousands of letters.

Well no. You can fit all of the information of what parts of your DNA make you onto a standard CD.

You've been arguing that it was all programed by hand starting from molecules and going up to the highest degree of interaction you comprehend.

But it's nice to finally get a formal irreducible complexity claim from you. I know that recognition of the simple steps leading up to what you're looking for wouldn't sway you in the slightest but it would disprove your claim by all reasonable standards.

Agnostic my ***. If that's what you were you wouldn't be dismissing non-designer views as happenstance. You'd have to be saying that happenstance and designer seemed equally likely and that you couldn't pick one, or better yet not calling it happenstance at all and addressing the actual view.

It's called tRNA. Look it up.

Other possible designers?

You're using the word "god" differently from the way I use it. If there are any designers of the universe, those designers is what I would call "god". They don't need to be affiliated with any particular mythology or religion.



Say what?

I offered one possibility. Where did I say anything about restricting that possibility to being the only possibility?

I haven't put a limit on anything. That was your own personal interpretation of what I wrote.





No kidding!

Well, if you want to talk about Intelligent Design you need to consider the existence of Intelligent Designers with no cause.

So now I guess were dead even.



Why should I care about anyone who isn't happy with my free speech? As long as they aren't in political power as a dictator I couldn't care less.

I can hold my own in a conversation with anyone. Can you? Or are you one of those people who would rather just silence those who you disagree with?

Sounds pretty drastic to me.



Wrong? I don't think so. I'm comparing the number of different kinds of atoms to the total number of atoms in the universe. So referring to the number of atoms as being 100 is perfectly legitimate in that context. It simply isn't necessarily to narrow it down precisely for that particular argument. A few atoms more or less isn't going to make one iota of difference, on the contrary such precision would only distract from the actual point that being made.

The point being made is that we live in an extremely clean universe. Something like DNA would be useless in a 'dirty' universe. With only about 100 different kinds of atoms, this universe is like a "clean room".

I guess you didn't understand the argument. That's the whole point. Mathematically, if atoms were happenstance, there is absolutely no reason we'd expect this universe to be the "clean room" that it currently is.

As a chemist (which I'm starting to believe you might be), can you imagine just for a moment what this universe would be like if there were hundreds of billions of different kinds of atoms instead of only on the order of 100?

Not only would that make your job far more difficult, but it would also make the job of DNA just about impossible. Why? Because there would be far too much "dirt" in the system to allow for a 'meaningful' coding sequence to even develop.

There'd be far too much random **** in the way!

The only way DNA can get away with becoming a coding molecule is for the very reason that this universe is indeed a statistical "clean room". Otherwise any nucleotides that did happen to exist would be surrounded by so much random happenstance clutter that they'd be luck to ever find another nucleotide to accidentally bump into, much less form long chains of nucleotides.

Oh, well, you don't seem to be getting the drift of this anyway. You'll probably just claim that the more clutter the merrier or something. But I don't think it works that way. A universe that filled with countless billions upon billions upon billions upon billions of atoms (so many that we can't even put a number to them) yet it only contains 100 different kinds of atoms?

That's a virtual CLEAN ROOM. Not at all what would be expected from a happenstance explosion, IMHO.

Your opinion may vary, as I'm sure it will.

Abracadabra,

There have been many people directly address your claims with both known(contradicting) scientific fact and logical refutation. The point is that they have directly addressed your words as they have been written.

Why is it that you have been only addressing what you think is improbable based upon a mathematical formulation which cannot even possibly exist? In order to give an equation for probability, there must be enough information concerning the possible causes for the given effects. Foundationally speaking, we do not have that information.

Does this not pose a problem to you?

This quote strikes me as odd...



Compared to what?

Anti-Creationist videos! I could show you hundreds of videos like this one. One of my favorite pastimes is watching the latest YEC nonsense refuted.

Please tell me that one was a joke. I counted 3 logical fallacies before simply closing the tab.