1 2 … 34 35 36 38 40 41 42 … 49 50
Topic: Evidence for a Designer...
no photo
Fri 11/06/09 02:25 PM
Edited by Jeanniebean on Fri 11/06/09 02:29 PM

The problem of course is that proper and conclusive arguments do further knowledge, and are useful.

That is the dip stick by which the intelligently designed universe argument falls apart. One step simpler is that the components of nature always was and needed no creator.


I addressed this statement before. I said you are right. Nature needs no "creator." Nature is programed to manifest by its own design. No creator needed.


The teleological argument is flacid and extends attributes of nature past where the evidence goes, this makes it non-scientific, this has been rigorously explained.


It is not "non scientific" if you use this definition of science:


The word “science” derives from a Latin verb, scire, meaning to know or to understand; it could thus properly apply to any process of comprehension of any topic or form of experience. But in contemporary usage the term has taken on an array of more specific implications, depending on the context, the user, or the audience. In some instances it connotes bodies of established technical knowledge, such as biology, chemistry, geology, or physics, or the technological applications thereof. In other situations it conveys more dynamic images of visionary, portentous research into new and exciting natural or cultural phenomena. In yet another variant, it refers to the communities of scholars and practitioners of such topics, or to the social authority they exert. Or finally, the term science can imply a methodology, or standard, or ethic of intellectual exploration that distinguishes its process from other less rigorous forms of human reasoning and creativity, regardless of the particular.

Science of the Subjective1

Robert G. Jahn and Brenda J. Dunne

Princeton Engineering Anomalies Research (PEAR) Laboratory
School of Engineering and Applied Science, Princeton University




At the end of the day we can take a teleological argument and fill the role of creator with any imaginary being and it still works . . . that is a very telling weakness.

Essentially this is why anyone schooled in logic, with a cognitively honest and objective view point will reserve the trite statements that design is obvious.


This is true. Anyone "schooled in logic with a cognitively honest and objective view point" would not dare venture beyond his restrictive scientific boundaries.

Its not obvious, in fact everything we learn about nature points away from purpose and design, to form and interaction.


Yes, it was designed to do that. Seriously.

It keeps the observer (us) focused on the objective (objects) so "things" can continue to exist. (Quantum mechanics-- that which is not looked at ceases to exist.) laugh

It was all in the plans. laugh laugh :wink: :tongue:

So you scientists keep looking and observing and recording and measuring and affirming. That could be the very thing that holds the fabric of this universe and this reality together!

Shoku's photo
Fri 11/06/09 03:18 PM
Edited by Shoku on Fri 11/06/09 03:32 PM
Sky:
Sky seems to be more of the first variety with some "reality is imaginary" solipsism thrown in.
I could see a tiny bit of what you said, previous to this, that had some relation to my beliefs. But I think it’s mostly out of context and thus much of my intended meaning is lost – particularly the “real is imaginary solipsism” part.
No, that's definitely solipsism. The other words were just there so people would know what I was referring to because I felt I should prime people's vocabulary to make sure they knew what that word meant.

So we do not yet have agreement as to what constitutes “disorder”.
No, I'm letting you use your definition. It's meaningless…
Yeah, that’s what I said. My definition is meaningless to you. But since you have not offered any definition at all, I don’t see any meaning coming from you either.
You're right, I've only said that legos built up as a castle would be order and legos scattered when a club hit that castle should be disorder. How could you ever find the implicit definition in that?

But you seem to be saying that what I consider to be disorder is irrelevant and only your view on disorder is valid.
If disorder does not exist anywhere you're using a word with a meaning but that meaning has nothing to do with anything in our universe so it's pointless to say anything about it.
And again, since you have offered no other meaning, my meaning stands because no other alternative has been offered. In the vernacular, put up or shut up.Thermodynamics for 200.

So can you give me words that describe the difference between a castle built out of legos and legos scattered about all over the place from what was basically just un-aimed destructive force?
Yes I can. But I don’t see any reason to. I’m not interested in a discussion where the only action is tearing down others views with no apparent interest in building up any mutual understanding.

You cause people to respond to you like this. The ideas you express only start people questioning you but it's the way you interact that makes everyone so hostile.

Importantly, this means nobody came here with the interest of tearing you down.

JB:
If you do not feel the need to prove what you say maybe debating is not for you?? Belief or otherwise.

There are cases where proof speaks for itself without any agreement from both sides. This should definitely be one of those cases. Because a designer would be very obvious if it existed.


No there are not. The 'proof' never 'speaks for itself' no matter what it is. It still requires agreement.

Designers are very obvious. I have given you examples. Now tell me why (to you) they are "not obvious" or (to you) they are not "evidence enough."

Instead of just making blatant assertions, tell my WHY you make these statements.

As far as 'debating' not being for me, I say again Proof is a matter of agreement.

If you are 'debating' and protecting your position with no intention of listening to the other side or looking at the evidence, then you are correct. That kind of 'debating' is not for me. I seek to find agreement, not to 'win a debate."

When you learn about the history of which scientists discovered which things you hear about a lot of people that hated each other. They disagree entirely because they're so disgusted by each other and they can't even stand to be in the same room (sometimes even when it's an auditorium,) but even in that situation one can gather up evidence for their work and the proof does it's work.

People disagreed with Columbus about it being possible to sail to another continent through the Atlantic but he went and did it and then made several return trips. He gave proof and then afterward people agreed, not the other way around.

Abra:
On a more atheistic side of things, let's assume that there is no intelligent designer.

This converstation and hypotheses still has much worth. In thinking about how intelligent design might be discovered or proven to be the case, I've been able to show that there is indeed evidence that points in that direction that is worthy of further investigation.
Like hell you have. You've been able to show that you don't understand many of the physical sciences or logic fallacies.

Also, from having engaged in this thread I've been stimulated to think of quite a few ideas concerning DNA and the human genome. Or I should say the Earthy Genome since the questions I have would apply to the DNA of every living thing on Earth.
DNA is a relatively arbitrary information molecule. Non-Earth life could very well use other carbon chain molecules for the same purpose, though relatively small and stable ones should have an advantage for obvious reasons.

The human genome project currently holds that all life on earth came from a single common cell.
Well I think I can rule out you being a biology teacher. The human genome project was a particular venture to sequence only the DNA of humans that took 14 years to complete but helped to drive advancements in DNA sequencing machines.

Genetics in general support the universal common ancestor concept though with more recent understanding of how much less distinct the species boundary was early on the tree of life has what resembles, slightly, roots. From DNA it's not possible to say that the original cell arose only once as the common ancestor itself may be have been a chimera of chemical products.
But presuming it did just happen once there was basically some incest in the family tree, though be careful to understand that context as at this point there would not have been sexual reproduction yet.

Their reasoning actually stems from the fact that every living thing they can find shares about 25% of the human genome.
That's a really inaccurate statistic. People have been saying that before the human genome project (and as we sequenced the full genomes of humans first we would have only had certain viruses and bacteria to compare it to. Currently we've sequenced most or the things we regularly eat and several species of interest.

But this is easily misleading. Sequencing a full genome is still expensive so a great array of techniques for picking out particular stretches to sequence. Often months and months of narrowing it down are preferable to paying the fee to sequence a large chunk of DNA.

Your statistic is most likely referring to mitochondrial DNA but who knows how many steps of the telephone game it could have gone through before you heard it.

Now, we do share surprising details with things even so different as bacteria. The general trend is that proteins inside of the cell are very nearly identical but plants, animals, and fungus (and some things I'm not going to explain,) have their major differences in proteins that stick through the membrane, which happens to be how cells communicate between each other. The same chains of interactions are there but the first step that sets them off is in the membrane for us so other cells can control it.

In other words, everything on Earth basically has the same DNA save for changes that have evolved only after the DNA had already become quite sophisticated.

It dawned on me as soon as I heard this, that this isn't the only plausible exlanation. A second explanation could be that no matter when or where DNA starts up, it always starts up with the same "boot-strap" program. And that program could be responsible for all creatures that have DNA to have very similar starting sequences.
That would be a good reason but it's clear you don't know the chemistry. There are hundreds of amino acids of varying types but we use only a particular set of 21. There are a few microorganisms that have a single change in their genetic code that uses a different amino acid and it works. It could work for us but we just don't use it.

Likewise there is a whole lot of other chemical setups that we COULD use but don't. There were lots of other chemicals available to us but much like a racing car you can't tack on every option there is if you want it to go fast; you've got to streamline things.
And some early cells did and we're all descended from them.

In fact, I've actually been quite interested in this question for some time now. Because, for me, the difference between these two scnearios is humongous.
If you want chemistry tutoring I can go into tons more detail~

If all life evolved from a single cell, like the human genome project holds, then life is very rare at getting started indeed.
Not at all. It could take thousands or millions of years for nonliving material to make all the parts for proto-cells but something like a bacteria- well those can divide in an hour if conditions are about as harsh as they can possibly handle and if you keep doubling like that you get billions of cells in just two days. Think how fast those would get into just about every corner and crevasse and you can see how they'd get everywhere and gobble up all the organic material to make more of themselves in the blink of an eye compared to how long it would take a second early cell to form.

Once there is anything to compete with abiogenesis doesn't have a snowballs chance in hell but if left alone for a million years it might happen practically everywhere it possible could.

On the other hand, if my hypothesis should happen to turn out to be true, then life may have started evolving in many different places quite easily. It just all looks similar because the only permissible "Boot-strap" program sequence automatically demands that it proceeds along a certain path before it can begin to diverge.

I'm sure that the Human Genome project will eventually get down to this boot-strap program. Potentially in as little as the next 20 years!
Inaccuracies aside that's pretty good. We've actually got the tools to start on it now and there are several people working on making a cell from scratch (to varying degrees,) but sadly, they probably won't get full results this decade.
But hey, you've got to start somewhere if you ever want to figure out how things work.

It's going to be extremely interesting. So many questions!

Is there only one possible boot-strap sequence?

Is there more than one? If so, how many?
For life like ours you need something like 30 genes to have a chance to function (based on comparing bacteria.) After we've worked that out in full detail (or close,) people will be able to realistically work on actual "from scratch" systems to accomplish the same thing.

Where do these boot-strap sequences 'send' the DNA (in terms of self-programming). In other words, if you could get two of these things started with the same boot-strap sequence, at what point would they begin to diverge?
Immediately. Mutations aren't programmed into the DNA, they happen with external conditions. Different sunlight, chemical intake, temperature differences (and really just about anything) can cause them and it's effectively impossible to put two copies in so identical an environment.
(Plus background radioactive decay isn't something we can any control over so we'd need whole other ways to make things "identical.")

You know how kids have a 50/50 chance of being a boy or girl? It's like that. If you had two identical sperm fertilize and egg you'd get the same gender child but you couldn't ever make the whole sex act so identical to definitely get that same result. Single parts in a test tube or petri dish and sure, you can control which will happen but as you add factors in it gets much harder to control.

How many neucleotides down the road before they could begin to diverge?
Well with sexual reproduction "diverge" refers to when the immune system makes the fusion of sperm and egg impossible but the lines are fuzzier with asexual reproducers.

These are fascinating questions.

And for me, they are even more facinating in terms of the programmer.

What was the programmer thinking who designed this molecule?

It's amazing what you can learn about a person from the way they program a computer. I used to teach computer programming at one point and let me tell you. You could give me a program that one of my students wrote and I could instantly tell you which student wrote the code.
I know all about that n_n
But is that the "science" you taught?

I would love to see this boot-strap program for the DNA molecule.

That would indeed be looking right at the "handwriting" of the creator of this universe.

I'm truly becoming so totally convinced of Intelligent Design that it doesn't even make any sense to pretend otherwise (even to myself).

The idea that DNA just happened by accident to be a self-programming molecule that could not only perform this self-programming task, but also have everything it takes to store that program, unfold it when it needs it, and not easily deteriorate!

My God! It would have been a miracle just to flimsy DNA to be able to become self-programming by pure happenstance. But to be able to not only be the program, but to be the 'hard-drive' TOO! And to be able to fold up and unfold as needed to expose just the right sub-rountines at just the right times? spock
Well if you want to think of it like that the deoxyribose backbone is the hard drive and the nucleotides are the program.

It's important to recognize that all of the parts that translate the program are like the programming language- DNA alone is just like a meaningless string of 1s and 0s if you don't have the right stuff to decode it.

-and like I said with JB, these aren't perfect comparisons. These are the closest I can compare and hopefully you get the general idea from it.

All that just happend by pure random accident?

I don't think so.

Someone designed that molecule and all the nucleotides that make it up. Someone designed these atoms. They aren't just happenstance.
So basically your evidence is "it seems crazy to me"? Of course new information doesn't sound like it makes sense in your understanding of the world- it's new. People thought the Earth going around the Sun instead of the other way around was too crazy to be true but they kept looking and people became familiar with more of the details and eventually people realized "ok, the way we thought it worked was too crazy to actually be it." (In particular the geocentric model with epicycles was wrecked but moons orbiting Jupiter and Shadows on the face of Venus ((sometimes it had to be closer than the Sun and sometimes further,) but these weren't absolute proof; it's just that that was the point where people understood well enough to recognize how much they would really have to do to make the geocentric model really work.)

That's crazy.
That's not a valid argument. Sorry but anybody acquainted with fallacies knows not to accept arguments from ignorance or ridicule.

I designed enough stuff in my life to know that there are far too many things that would need to come together for this to have just been a freak accident.

This universe was definitely DESIGNED.
So basically you're saying it is irreducibly complex? That argument was shot down back in Kansas.

As far as I'm concerned DNA itself is the all the proof anyone should need. I'm really in shock that scientists are still pretending that this could have happened by pure random chance.

It has nothing to so with TIME, or how long DNA had to 'evolve'. It's the simple fact that it CAN DO IT that should be all the evidence that's needed.
I don't see the connection. Why shouldn't the results of the big bang act this way without a designer behind it? Seems like most of it is just the simple math of "things that happen more often are the ones you will see the most of."

Any time factors are totally irrelevant.

This universe was designed.
Again, why? What's the limit of what things without design should be able to do? Why is that the limit? If you've designed so many things why not say that too few things have gone wrong for it to be designed?

Abracadabra's photo
Fri 11/06/09 03:23 PM
JB wrote:

So you scientists keep looking and observing and recording and measuring and affirming.


What scientists?

Are you referring to these people who totally abuse and misrepresent science for their own philosophical agendas? spock

There is no respectable way that science can be used to support a conclusion of no-design.

That's a total farce to begin with.

Look at the arguments that are being given for that:

The only argument they truly have is that their claim that happenstance should somehow be a simpler "explanation" than design, and they appeal to Occam's Razor as their "scientific support" for that absurd conclusion. laugh

Is that even the "Scientific Method"?

I don't think so!

That's an utter misunderstanding of both the "Scientific Method" and Occam's Razor.

The Scientific Methods does not say, "Ignore all evidence and take what you think should be the simplest guess in your own personal opinion!". laugh

That is not science!

Science says to observe the evidence, and then try to explain THAT as simply as you can and still actually explain it!

Was Classical Newtonian physics simple? Yes!

Did it explain? Well, it seemed to for a while until we found things that it couldn't explain, then we had to give it up even though it was a 'simple theory', it still failed to explain.

So being simple is not enough!

It must also explain!

We had to give up that simple explanation in favor of General Relativity and quantum mechanics, simply because the simple explanation no longer explained anything.

We're even finding out that these more complex theories fail to explain everything!

Scientists have invented String Theory to try to explain things. It's extremely complicated and hasn't yet explain anything. laugh

So where does this passionate argument that explanations must be simple come from?

It's not from Occam's Razor. Because Occam's Razor doesn't say anything about explanations needing to be simple.

All that Occam's Razor says is that IF you can explain something simply don't bother making it more complicated. Because you already have a simple explanation! Why bother dreaming up a more complex one? laugh

But Occam's Razor can't be applied to a guess that the universe was happenstance, because that guess, doesn't explain anything, nor does it even fit the data!

The data suggests that something more than happenstance is going on!

So why should scientists ignore the evidence in favor of a supposedly "simple" guess that doesn't even explain anything? ohwell

And they call that, "The Scientific Method"? slaphead

It can't even be justified via Occam's Razor!

It's not even an explanation and it doesn't even fit the evidence that we observe.

So how does it even qualify as science? huh

It's not science.

It's a gross misrepsentation of science being used to try to shove an atheistic philosophy down the throats of people in the name of science. ohwell

If you people want to argue against particular religions, be my guest. You should be able to find enough ammunition to argue against their mythological dogmas without having to abuse science in the process.

In the case of the Bible, just argue that mankind cannot possibly be held responsible for bringing imperfections and death into the world because science has legitimately shown that imperfections and death existed long before mankind ever came on the scene.

That should be enough right there.

No need to take a stupid stance against intelligent design just to try to shut up bigoted religious fanatics.

Let's get our priorties in line with reason.

Let's not let religious mythologies turn scientists into atheistic fundamentalists just because some religious suck.

That's going way overboard.

Even if this religion was designed by some intelligence that doesn't support the ideologies preached by many religious dogmas.

That's not an automatic given and fears that it might be taken as a green-light for that is an misplaced fear.

It's far better to take the stance that evidence for intelligent design does not automatically mean that any particular religious dogmas are true.

The Bible holds that mankind is responsible for bringing imperfections and death into the world. That's still false based on scientific evidence, even if Intelligent Design is true!

We have scientific evidence that imperfections and death existed long before humans evolved. So that dogma is caught in a lie no matter what! bigsmile

SkyHook5652's photo
Fri 11/06/09 03:48 PM
Edited by SkyHook5652 on Fri 11/06/09 04:14 PM
The problem of course is that proper and conclusive arguments do further knowledge, and are useful.

That is the dip stick by which the intelligently designed universe argument falls apart.
Well of course that must be qualified. It cannot be said definitively that a “proper and conclusive argument” is impossible. Only that one has not yet been observed.

But the interesting thing there is that the only proper and conclusive argument possible would be to actually observe an instance of intelligent design, in which case, “logical argument” would be moot. :laughing:

And personally, I consider the man/machine interface research done at PEAR to be exactly that – direct scientific observation of intelligent design. (Not of “an entire universe” of course. But at least a “portion of” a universe. But that is enough to open up the qualitative category. From there it’s just a matter of quantity.)

One step simpler is that the components of nature always [were] and needed no creator.
If one considers time to be a “component of nature”, then that statement strikes me as being no less trite than any other statement. It’s simply stating that time always existed. One might just as well say “infinity is infinite” or “an apple is an apple”.

The teleological argument is flaccid and extends attributes of nature past where the evidence goes…
I don’t think it does – again referencing the PEAR research.

At the end of the day we can take a teleological argument and fill the role of creator with any imaginary being and it still works . . . that is a very telling weakness.
Weak how? How do you measure the weakness?

With “Logic”?

Well in that case you would be absolutely right.

But again, since logic itself is a creation, all you’re saying is that the contents of the box cannot prove the existence of a creator of the box.

And I don’t see anyone disagreeing with that.

Essentially this is why anyone schooled in logic, with a cognitively honest and objective viewpoint will reserve the trite statements that design is obvious.

Its not obvious, in fact everything we learn about nature points away from purpose and design, to form and interaction.
If by “everything we learn about nature” you mean “everything science learns about nature”, then I have to point out that no purpose or design has ever been looked for by science. All it ever looks for is form and interaction. By it’s very nature it cannot point to purpose or design. It’s very foundation requires that it specifically ignore purposed and design.

So “everything we learn about nature points away from purpose and design, to form and interaction” is not all that strong of an argument either.


In summary, the arguments against design all amount to simply “because we can’t see anything but the inside of the box, there is no reason to assume that the box has an outside.”

Well, that’s fine for scientists. That’s their job – to observe and categorize the contents of the box.

The job of Philosophers, on the other hand, is to beg the question – what’s outside the box?

What if “creation” outside the box had the same qualities as creation inside the box? I.e. subjective purpose and intent. What would that explain?

Well, it would explain a lot. It would explain pretty much all the paranormal/metaphysical phenomenoa every observed. And it wouldn’t contradict anything science had already explained.

Works for me. biggrin

SkyHook5652's photo
Fri 11/06/09 04:11 PM
Edited by SkyHook5652 on Fri 11/06/09 04:11 PM
Sky:
Sky seems to be more of the first variety with some "reality is imaginary" solipsism thrown in.
I could see a tiny bit of what you said, previous to this, that had some relation to my beliefs. But I think it’s mostly out of context and thus much of my intended meaning is lost – particularly the “real is imaginary solipsism” part.
No, that's definitely solipsism. The other words were just there so people would know what I was referring to because I felt I should prime people's vocabulary to make sure they knew what that word meant.
Then I’ll just say that I don’t agree with solipsism.


So can you give me words that describe the difference between a castle built out of legos and legos scattered about all over the place from what was basically just un-aimed destructive force?
Yes I can. But I don’t see any reason to. I’m not interested in a discussion where the only action is tearing down others views with no apparent interest in building up any mutual understanding.
You cause people to respond to you like this. The ideas you express only start people questioning you but it's the way you interact that makes everyone so hostile.
That must be true because I am cause and everyone else is effect. I control everyone and there’s nothing they can do about it.

Well I’ve always maintained that one creates one’s own reality, so I cannot deny the absolute truth of what you said there.

It’s all my fault. biggrin

LaMuerte's photo
Fri 11/06/09 04:29 PM




If you are speaking only of the physical universe you are probably correct.

But this is probably a multi-dimensional infinite universe.


This particular Universe is not infinite, by any current theory. Either your terminology or your logic is flawed.



I said you are correct. This particular "physical" universe may not be "infinite." Don't be so quick to judge my logic when I am in agreement with you.

However, this is not the only universe.


I'm pointing out that even if there are multiple Universes, it's more likely that none of them are infinite, and judging by the behavior of this one (i.e. expansion and possible collapse) I'd say it's safer to assume that it's less probable that any of them are infinite. Saying that this is probably a Multiverse, like that suggested by String Theory, seems a lot like you're adding probability where there isn't necessarily any likelihood at all. If String Theory really is correct (and by all means, I hope it is) then yes, there are multiple Universes and up to or more than 11 dimensions.

Abracadabra's photo
Fri 11/06/09 04:55 PM
Shoku wrote:

If you want chemistry tutoring I can go into tons more detail~


Thank you for the offer, that is very kind of you, but I have no need for tutoring in chemistry I'm fully aware of the principles of chemistry.

You got caught up in some 'crosstalk' there between myself and Redykeulous. I was just sharing with Di some interesting things about DNA because I knew that she would find them interesting. However, those conversations had nothing to do with my original argument.

My original argument is based on the fact that the chemical elements are so few, (only about 100) and that they clearly aren't happenstance. They are clearly all related very dependently. This is shown by both Mendeleeve and by Quantum Mechanics.

The point being that a molecule like DNA wouldn't even be able to exist in a genuinely chaotic universe. So by the time we get to DNA we're long since past the edvience for design.

So once you have DNA in your hands, you're already holding the evidence for design.

My discussions of DNA were just sharing interesting ideas with Di.

DNA would not even be able to exist in a genuinely happenstance universe. A genuinely happenstance universe wouldn't be 'clean' enough.


no photo
Fri 11/06/09 05:07 PM
Edited by Jeanniebean on Fri 11/06/09 05:39 PM





If you are speaking only of the physical universe you are probably correct.

But this is probably a multi-dimensional infinite universe.


This particular Universe is not infinite, by any current theory. Either your terminology or your logic is flawed.



I said you are correct. This particular "physical" universe may not be "infinite." Don't be so quick to judge my logic when I am in agreement with you.

However, this is not the only universe.


I'm pointing out that even if there are multiple Universes, it's more likely that none of them are infinite, and judging by the behavior of this one (i.e. expansion and possible collapse) I'd say it's safer to assume that it's less probable that any of them are infinite. Saying that this is probably a Multiverse, like that suggested by String Theory, seems a lot like you're adding probability where there isn't necessarily any likelihood at all. If String Theory really is correct (and by all means, I hope it is) then yes, there are multiple Universes and up to or more than 11 dimensions.


Infinity is the key to the underlying structure of all things.

Assumptions on the finite nature of Nature.

Despite the harshness of attacks, David Bohm remained unswerving in his conviction that there was more to reality than Bohr's view allowed. He also felt that science was much too limited in its outlook when it came to assessing new ideas such as his own, and in a 1957 book entitled "Causality and Chance in Modern Physics", he examined several of the philosophical suppositions responsible for this attitude.

One was the widely held assumption that it was possible for any single theory, such as quantum theory, to be complete. Bohm criticized this assumption by pointing out that nature may be infinite. Because it would not be possible for any theory to completely explain something that is infinite, Bohm suggested that open scientific inquiry might be better served if researchers refrained from making this assumption.

Abracadabra's photo
Fri 11/06/09 05:09 PM
LaMuerte wrote:

If String Theory really is correct (and by all means, I hope it is)


If I may ask? (just out of curiosity):

Why do you hope that String Theory is correct? flowerforyou


LaMuerte's photo
Fri 11/06/09 05:56 PM
Edited by LaMuerte on Fri 11/06/09 06:01 PM

LaMuerte wrote:

If String Theory really is correct (and by all means, I hope it is)


If I may ask? (just out of curiosity):

Why do you hope that String Theory is correct? flowerforyou




Because it's a marvelously elegant theory, and is as of yet the closest we've come (mathematically, at least) to unifying Quantum Mechanics with General Relativity. Because the concept is so intriguing I would just very much like it to be correct.

no photo
Fri 11/06/09 06:34 PM
Edited by Bushidobillyclub on Fri 11/06/09 06:39 PM
Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div


No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?

SkyHook5652's photo
Fri 11/06/09 07:21 PM
One step simpler is that the components of nature always [were] and needed no creator.
If one considers time to be a “component of nature”, then that statement strikes me as being no less trite than any other statement. It’s simply stating that time always existed. One might just as well say “infinity is infinite” or “an apple is an apple”.
And now that I think about it, one could simplify it even more and just say “the components of nature are” and leave it at that – no complex investigation, explanation or understanding needed.
drinker

SkyHook5652's photo
Fri 11/06/09 07:24 PM
Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div

No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?
Yeah, fun vid. I like the background music. Gives it sort of a humorously sarcastic, "keystone kops" kinda feel. :laughing:

no photo
Fri 11/06/09 08:40 PM

Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div


No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?


http://www.youtube.com/watch?v=o2RD4vTuPN0&feature=fvw

Shoku's photo
Fri 11/06/09 08:54 PM

Di wrote:

QUESTION FOR ABRA:

When looking into creating a hypothesis for an inelligent design theory how would we decide whether to look for a single force capable of willing matter into being, or a programmer geek type god who created a matrix type game comeplete with humans for role playing? Or perhaps we should look for a complex energy source formed by a combination of free agents that decided to build a matrix through which to recreate their essence in various physical forms for the pure enjoyment of experiencing such forms?

How would you proceed, as a scientist, I mean?


Well, for starters I wouldn't be looking for the actual designer. As far as I'm concerned that would be futile for the following reasons:

1. If the designer wanted to be revealed we'd know it. laugh
No. If God wanted to be revealed we'd know. There are lot of reasons other possible designers would be limited in action.

The designer would just reveal itself. So clearly if there is a designer, that designer either can't, or won't reveal itself.

If we are the designer, that explains why the designer is not revealing itself. It's a game where the designer gets lost in the game until it FINDS itself. So revealing itself to itself would be counter-productive to the very nature of the game.
That's an awfully limited number of ways we could be the designers. Why couldn't we have designed this without knowing we were doing it do example?

2. It is my understanding from the mathematics of Quantum Mechanics that certain knowledge exists that is physically beyond our reach.
That or cause and effect aren't quite so definite as we wish they were.

The mathematics of QM demands that we cannot know certain things.
Not so much the math. The trouble is that when a photon hits something and bounces back it nudges it a little bit. Thanks to this if we figure out how fast something was going we moved it around enough that we don't know where it was and if we figure out where it was we bumped it enough that we don't know how fast it was going.

And this isn't because we're not clever enough. It's because this is the nature of physicality. As long as we are in physical form there are certain things about the nature of the quantum field that we can never possibly know, no matter how sophisticated we get.
Non-particle based information gathering might not be impossible in our physical forms. If you accept psychics and things they can't be doing what they do with everyday particles and the exotic ones usually wouldn't interact with our matter much anyway, much less whatever they wanted to get information from.

It's forbidden by the mathematics. Period amen.

So either Quantum Mechanics is wrong, or certain information has been forever 'hidden' from us.
Or it's not information at all. Things like radioactive decay happen in statistically predictable ways but the decay of a single atom doesn't even have quantum causes behind it. If you want to talk quantum physics you need to accept that decay as an effect without a cause.

If there is an Intelligent Designer, then it makes sense to take that as an act of the Intelligent Designer to purposeful forbid us from discovering its darkest secrets.
The hell? We can still find out any particular thing, just not certain combinations and other than stuff like the "let's try to make ultra-identical twins" scenarios knowing all of that wouldn't have much practical use anyway.

So we're left with having to be satisfied with just finding evidence of a designer.
So if the designer wanted to be revealed it would but instead we have to settles for the stuff that... uh, reveals it? What? You're not even making sense.

1. My first goal would be:

Look at the system and see if happenstance explains it.

If it explains it then I'm done and I don't even need to consider an Intelligent Designer.

So I do that. I'm not happy at all with happenstance as an explanation.

And there are people in here that aren't happy with you having free speech but that doesn't have any impact on your having it or not.

Happenstance doesn't explain what I see. To believe this universe is happenstance would be far more outrageous then accepting that the Mona Lisa had been created by a garbage truck splashing mud on a canvass by driving through a mud puddle.
Well ya, mud doesn't contain the green and red pigments you see in that and probably wouldn't do a good job of the blue ones either.

Meanwhile non-life has all of the "pigments" and once you get certain combinations of them they go making more of themselves.

It's not a suitable explanation.

2. My second goal would be to make that result more meaningful

I've already explained in detail why it's unrealistic to think that only 100 random happenstance elements should just accidently do all the things that elements do in this universe.
I know I've been a day or two behind in this but I'm pretty sure my post where I explained that you were wrong about there only being 100 was before this.

Particularly building themselves into conscious sentient beings.


3. My third goal, would be to look more closely at that DNA programming, particular the "Boot-strap-loader"!

I don't know if you're familiar with what that is, but no computer program can run without one. DNA necessarily must have a "Boot-strap-loading" sequence. That would be my third goal. To study that boot-strap loader in extreme detail.

Unfortunately I don't believe that even the Human Genome Program has a clue where that particular DNA sequence is yet. But I would love to study that baby!
CAGGACGGACAACATGTCAGAGCTAGCTACCATGCATAGC
Doesn't mean squat to you does it? Picture that stretching on for hundreds of thousands of letters.

That's precisely where I'd go.

I'm sure they'll find it eventually and when they do that's going to be an extremely exciting time in genetics.

Unfortunately, they'll probably just say, "Look! We found the boot-strap-loading sequence! No need for any God!" laugh

What a bunch of idiots if they do that! whoa

There is so much information that can be had from that little piece of code. That would be GOLD! I'd love to get my hands on that little strip of DNA. What a book that would be! No matter how small it is, the information contained in that boot-strap-loader will be enormous.
Well no. You can fit all of the information of what parts of your DNA make you onto a standard CD.

That would be the information that the designers programmed in by hand! "so-to-speak"
You've been arguing that it was all programed by hand starting from molecules and going up to the highest degree of interaction you comprehend.

But it's nice to finally get a formal irreducible complexity claim from you. I know that recognition of the simple steps leading up to what you're looking for wouldn't sway you in the slightest but it would disprove your claim by all reasonable standards.


And one last question - in case your theory hits dead end, what is your "default" - as a scientist that is?


As a scientist I have no "default". If I don't know something I just say so.

Agnostic ring a bell? bigsmile

That's exactly where I'm at right now.
Agnostic my ***. If that's what you were you wouldn't be dismissing non-designer views as happenstance. You'd have to be saying that happenstance and designer seemed equally likely and that you couldn't pick one, or better yet not calling it happenstance at all and addressing the actual view.

Although, I confess that I lean toward a designer because as far as I can see that's where the evidence is pointing.

Give me that little DNA boot-strap loader and I'll tell you volumes about the Intelligent Designer. bigsmile
It's called tRNA. Look it up.

Abracadabra's photo
Fri 11/06/09 09:41 PM
Shoku wrote:

No. If God wanted to be revealed we'd know. There are lot of reasons other possible designers would be limited in action.


Other possible designers? huh

You're using the word "god" differently from the way I use it. If there are any designers of the universe, those designers is what I would call "god". They don't need to be affiliated with any particular mythology or religion.

Shoku wrote:

That's an awfully limited number of ways we could be the designers. Why couldn't we have designed this without knowing we were doing it do example?


Say what?

I offered one possibility. Where did I say anything about restricting that possibility to being the only possibility?

I haven't put a limit on anything. That was your own personal interpretation of what I wrote.

Shoku wrote:

If you want to talk quantum physics you need to accept that decay as an effect without a cause.


laugh laugh laugh

No kidding!

Well, if you want to talk about Intelligent Design you need to consider the existence of Intelligent Designers with no cause.

So now I guess were dead even. :wink:

Shoku wrote:

And there are people in here that aren't happy with you having free speech but that doesn't have any impact on your having it or not.


Why should I care about anyone who isn't happy with my free speech? As long as they aren't in political power as a dictator I couldn't care less.

I can hold my own in a conversation with anyone. Can you? Or are you one of those people who would rather just silence those who you disagree with? huh

Sounds pretty drastic to me.

Shoku wrote:

I know I've been a day or two behind in this but I'm pretty sure my post where I explained that you were wrong about there only being 100 was before this.


Wrong? I don't think so. I'm comparing the number of different kinds of atoms to the total number of atoms in the universe. So referring to the number of atoms as being 100 is perfectly legitimate in that context. It simply isn't necessarily to narrow it down precisely for that particular argument. A few atoms more or less isn't going to make one iota of difference, on the contrary such precision would only distract from the actual point that being made.

The point being made is that we live in an extremely clean universe. Something like DNA would be useless in a 'dirty' universe. With only about 100 different kinds of atoms, this universe is like a "clean room".

I guess you didn't understand the argument. That's the whole point. Mathematically, if atoms were happenstance, there is absolutely no reason we'd expect this universe to be the "clean room" that it currently is.

As a chemist (which I'm starting to believe you might be), can you imagine just for a moment what this universe would be like if there were hundreds of billions of different kinds of atoms instead of only on the order of 100?

Not only would that make your job far more difficult, but it would also make the job of DNA just about impossible. Why? Because there would be far too much "dirt" in the system to allow for a 'meaningful' coding sequence to even develop.

There'd be far too much random **** in the way!

The only way DNA can get away with becoming a coding molecule is for the very reason that this universe is indeed a statistical "clean room". Otherwise any nucleotides that did happen to exist would be surrounded by so much random happenstance clutter that they'd be luck to ever find another nucleotide to accidentally bump into, much less form long chains of nucleotides.

Oh, well, you don't seem to be getting the drift of this anyway. You'll probably just claim that the more clutter the merrier or something. But I don't think it works that way. A universe that filled with countless billions upon billions upon billions upon billions of atoms (so many that we can't even put a number to them) yet it only contains 100 different kinds of atoms?

That's a virtual CLEAN ROOM. Not at all what would be expected from a happenstance explosion, IMHO.

Your opinion may vary, as I'm sure it will. drinker


creativesoul's photo
Fri 11/06/09 09:58 PM
Abracadabra,

There have been many people directly address your claims with both known(contradicting) scientific fact and logical refutation. The point is that they have directly addressed your words as they have been written.

Why is it that you have been only addressing what you think is improbable based upon a mathematical formulation which cannot even possibly exist? In order to give an equation for probability, there must be enough information concerning the possible causes for the given effects. Foundationally speaking, we do not have that information.

Does this not pose a problem to you?

creativesoul's photo
Fri 11/06/09 10:30 PM
This quote strikes me as odd...

The point being made is that we live in an extremely clean universe.


Compared to what?

huh

LaMuerte's photo
Fri 11/06/09 11:02 PM

Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div


No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?


Anti-Creationist videos! I could show you hundreds of videos like this one. One of my favorite pastimes is watching the latest YEC nonsense refuted.

LaMuerte's photo
Fri 11/06/09 11:06 PM


Creationists must deny: http://www.youtube.com/watch?v=5nj587d5ies&feature=rec-HM-fresh+div


No real point, just a cool vid, I think most here accept evolution . . . right? No YEC's right?


http://www.youtube.com/watch?v=o2RD4vTuPN0&feature=fvw


Please tell me that one was a joke. I counted 3 logical fallacies before simply closing the tab.

1 2 … 34 35 36 38 40 41 42 … 49 50